Hejdå!





Kommer ni sakna mej????? Klart ni kommer. Jag kommer sakna er med.
Men hörs igen om 20 dagar! Om vi nu inte blir uppäten av en kamel eller nått annat konstigt där ute i öknen. Hur som hellst, ha det bra alla ni söta, och så lovar jag en massa spännande bilder och videoklipp från äventyret nästa gång det blir uppdatering här på bloggen!
Vi hörs! puss puss puss puss!



I'm Ready!


Vårt hem de närmaste 20 Dagarna..


Last walk in Frankston

Och faktist, FÖRSTA GÅNGEN JAG SETT SOLEN GÅ NER, I HAVET, I AUSTRALIEN. Tror jag?
Öööh alltså, jo, jag har ju varit här i landet över ett år..




Men det är, som ni vet, i Sverige går solen aldrig ner i havet, men i Finland gör den det. 10 poäng till Finland för det!!! 0.5 poäng till Sverige, vem gillar att se solen gå ner mellan talltopparna? Och 10 poäng för Australien, eftersom du kan se den gå ner i öknen, havet, palmtopparna, bergen eller de gröna kullarna beroende på var i landet du är.


We're higher then a MOTHERFUCKER

Alltså, jag gillar ju inte ens Nicki Minaj..........






Förlåt, men ..

.. det blir en




Inte tackvare alla tönt kommentarer som kom in här på bloggen förra veckan (jag lovar, ni tar inte död på mej så enkelt) utan för att jag reser vidare. Vi, Simon & jag, lämnar huset vi bott i de 2 senaste månaderna här i Frankston imorgon. Dehär är vår plan:



Japp, därför vi har köpt en skrotbil som säkert inte kommer klara 4800 km. Behöver ju lite spänning alltså!!!!! Vad är inte det ultimata äventyret om inte en brinnande bil / exploderande motor / tappande däck / sprucken ruta / eller punktering efter att ha kört på en kaktus mitt ute i ingestans där inga andra bilar finns? Dehär lär ju bli mera äventyrligt och överlevnads test än Robinsson eller Fångarna på Fortet. Jajjamensan!




Vi räcknar inte med duschar, toaletter, elektrisitet, tvättmaskiner, telefon kontakt, andra bilister, socialt umgänge och andra levande varelser på två ben än oss själva, så gissa om internet finns på listan vi räcknat med? NÄ.

Great Ocean Road och vägen fram till Adelaide borde vara helt okej befolkad (så om ni har tur och vi stannar på ett McD och dricker en milkshake (OBS! Som inte kommer hända) då kanske ni får blogguppdatering), men efter det, mellan Adelaide och Perth, finns inte mycket annat än sandkorn. WOHO! Inte sådär överdrivet befolkat alltså.

Men, uppdaterar er imorgon innan vi åker, lovaaaaaar!




My Poni! Yeah I know, I'm just showing off, tihi


GP F1 in Melbourne, Day 4 - FINAL


GP F1 in Melbourne, Day 3


New Shit


Sista Middagen i Melbourne, in Chinetown

PAD THAI for life säger jag bara.
Och Starbucks White Chocolate Mocha. <3


packar...


Kukförlängare

Som vi alla vet, så killar med snabbt rörande saker, motorer som vrålar och annat sånt där coolt manligt vi tjejer inte fattar oss på, gör killen i fråga tusen gånger mera intressantare, och konstigt nog, ett par tusen gånger snyggare också.



Så från att aldrig ens haft tanken på att vår finska stolthet Räikkönen ser ens aningen cool ut från att tro att det är den snyggaste finnen jag sett?! (Fast egentligen ser han ju inte ens SÅ bra ut, eller?!?!). Och första reaktionen när jag såg en bild av Kovalainen, för första gången, var; "what the fuck?!?!?! HE LOOOOOOKS GOOOOOD!!!!". Sen när har Finnar börjat se snygga ut? Aldrig.



Fast, jag älskar 'extrem' sport killar överlag. Sexigaste som finns. Och i min värld betyder ju det att alla som kan surfa, snowboarda, åka moppe, klättra, trixa med cykel, vara cool, åka snabbt i saker, göra trix på hästar och shit är MMMMM. Även fast de skulle ha ett ap ansikte så skulle jag ändå gilla dem så länge de kan göra något coolt. Nä vadå svår impad? Fast funkar också att dom bara ser wannabe coola ut. Liksom, Fox kläder, keps, baggy jeanse, lagom långt hår, dricker Monsters/RedBulls.... MMM! Inte direkt så jag går igång på att se vem som dricker en öl snabbaste.


Spot

Konstigt nog så hade vi turen att få super duper bra platser inför final loppet på racet!
Behövde inte stå och trängas super tätt med 130 tusen andra människor
(denhär gången överdriver jag faktist inte mängd summan!).



Så jaha, vad är det för bra med dehär platserna då, tänker ni?
Jooo, för att vi hade inte betalat 300$ för en dags Grandstand (det är de som sitter på läktarna som gjort det) så det betyder att vi andra, dödliga, bara kan stå runt banan och tittar på. Enkelt att stå var som hellst, välja en kurva där alla andra står i, men då vet man ju inte vad som pågår i racet? Om man inte har super hörsel och kan höra radion igenom öronpropparna. Så det absoluta bästa är att ha en stor skärm framför sig. Som inte det finns alltför många utav. Speciellt inte alltför många som det inte redan står, oskojat, tre tusen människor och trängs framför. Men vi stog precis framför en skärm (alla andra, minst 5 tusen, stog på andra sidan banan och trängdes, därifrån man såg skärmen bättre), precis vid banan, precis mellan två kurvor efter startlinjen. Perfectooo. Så vi kunde både se bilarna susa förbi 5 meter ifrån oss och följa loppet i minsta lilla detalj på skärmen.


Just got Home

Aaaah, kom precis hem från den långa sista super dagen i Albert Park.
Jag loooooovar, jag kommer gå på Formula1 live många många fler gånger efter dethär! Det är awesome. Ni tror bilarnas motorer låter porrigt igenom tv rutan? Nej guuu så fel, om jag vore kille skulle jag nog komma i byxorna av att höra det på riktigt.

Nu e vi sliiiiiitna. Så bilder från tredje och fjärde
dagens Grand Prix kommer komma imorgon, ok?



Happines; when u find the latest Zoo-Magazine on the long boring train home <3


Gissa, 3 gånger, vem som bränt sig idag!


Nödvändig BloggFakta for Life <3

En sak som vi alla bloggare vet om varandra är hur vi ser ut i ANSIKTSMASK!

Kan dock konstatera att jag inte skulle se snygg ut som Snövit eller som ett spöke..
Detdär bleka är då inte riktigt min färg må jag då säga.....



Jaa visst lär man sig mycket genom att läsa bloggar? Livsnödvändig fakta.
Jag menar, vem behöver inte kunna identifiera människor i ansiktsmask?
Tänk om jag smyger ut på Jakobstads gator och tror ingen ska känna
igen mej med en massa gegga i facet, men så vet alla redan hur jag
ser ut med det i.
Kan inte råna en bank med en ansiktsmask på
efter dehär inlägget..

Jag vet då inte om det är just därför alla bloggare uppdaterar sina bloggar med hur de ser ut med lite lera i fejjan? Ni måste då hålla med om att det är en populär återkommande blogg uppdatering i många bloggar. En väldigt så meningslös en också.


F1 today


F1 GP in Melbourne, Day 2




Det var kyligare idag än igår, så satte på mej halv-lång ärmat och långbyxor. Ångrade mej direkt jag kom in till Melbourne och solen värmede perfekt. Sen någon timme efter spö regnade det. Hur glad var jag inte då att jag inte satt på mej en klänning? Så vi blev genom blöta och rörde oss hemmåt. Så en ganska så kort dag, några timmar. Men han se första practice session av F1! COOOOL. Ni skulle höra ljudet av bilarna! MMMMMMM, sex. Och så såg vi Crusty Demon uppträda idag och Jet Pack Man! Mera imorgon..




Pappas Flicka

Ibland får jag vibbar av att min pojkvän påminner om min pappa?

Öhm, låter ju väldigt sjukligt fel, men inte på det viset! Okej? Bara liksom små saker. Saker han gör för mej som min pappa också alltid gör för mej. Så som att passa upp mej 24/7 (OHJAA, om man är född princessa såååå..?), ger mej massage och rör mej precis så mycket som jag vill (om jag tjatar en liten stund först, förståss..), gör mej mat (när jag skriker och slår med gafflar och knivar på matbordet först. "Flygande mat" exicterar fortfarande i min värld ((flygande mat är vad jag kallar när mat plötsligt uppenbarar sig från tomma intet och landar framför mej på bordet/sängen när jag gnällt efter det tillräckligt länge)) ), hämtar saker för mej, låter mej slå på honom, håller koll på mej, fixar saker för mej och allt annat såntdär..



Och när jag såg dethär i en helt ny bäddad säng (som JAG självklart INTE hade bäddat. Någonsin hört om en princessa som bäddat sin säng? Nej trodde väl inte det.) så behövde jag verkligen titta runt mej om pappa stod gömd i nått hörn?! Maaaaaw.. Ingen annan än pappa sätter mina gosedjur till bädds.



Fast jag har läst att man dras till män som påminner om ens far.
Så jag gissar att jag har rätt. Eller är jag den enda?


I väntan

Nu har vi precis kommit hem från dagens F1 visit. Vi är dyng våta (tack vare the lovely Melbourne vädret) och as sena och sura tack vare Melbournes awesome tåg (som någon bestämt sig att köra ut framför och tvingade 387 miljoner Melbournebor att ta det tusen miljoner timmars långa bussen hem istället för den bara hundra timmar långa tåget). YES precis vad vi vill ha en fredags eftermiddag, genom blöta, mitt i rusnings trafiken!


Så i väntan på dagens Formula bilder ska ni få bilder av meeeeej! *publikens jubel*
Denhär kvällens outfit kallar jag kall-frusen-kattunge-i-pojkväns-jumper. Som ni ser så kombinerar jag den med fötter från en zebra, som jag precis sköt ute på bakgården. Sen drog jag ut hjärtat med bara händerna. Genom halsen. Innan jag drack blodet. Och smetade lite utav det i håret som en extra behandling. Vem vill inte ha Loreal hår? Och jag sparade självklart hjärnan. Vet aldrig vilken dag jag behöver byta ut min egen! Som sagt, man blir ju lite extra manlig utav att kolla på snabba bilar dagarna i enda. Och så överdriver jag aldrig.






Sneak peak from Today


puss Gonatt


F1 GP in Melbourne, Day 1




Jaha ja, då var det igång..
Årets första Formula 1 Grand Prix. Eller, egentligen är det ju på söndag. Nu är det ju bara en massa upp värmning, träning och extra program innan dess. Som sagt så är jag, fröken Pessi, super manlig och har biljett till alla 4 dagar av Formula yran. Så de närmaste dagarna kommer det bli en massa GP pics här på bloggen. Kanske inte intressantare än bröst, men nåja.




Crusty Demons kunde inte uppträda för att det var blåsigt (och så regnade det, och sen kom solen, och sen försvann blåsten, och sen regna det och var soligt samtidigt, och nu är det åska.. Välkommen till Melbourne!) så de va ju lite tråkigt.. V8 bilarna ser inte lika sexiga ut på bild som deras motorljud låter (ska filma och sätta upp!) och Formula Ford bilarna var väl söta? Eller nått. Så mera 'action' bilder kommer väl närmare helgen..



Vrooooooum


First Day!


PowerWalk


Vet ni vad..

Jag har köpt en....



Eller en halv bil, egentligen, om vi nu ska vara petnoga med detaljerna.
Jag vet, ganska så snygg en. Observera hur mycket den skimmrar *bling bling*. Årsmodell 2011. Eller nått sånt. Nä men en sliten sönder körd Ford som jag betalat, min del 300$ för, är väl inte så dålgt, vaaa? Sen när den dör, kokar, brinner bort, tappar ett däck, rutan spricker eller whatever, mitt ute i ingenstans, DÅ kanske 300$ känns lite onödigt mycket istället för 700$ för en hyr bil som inte går sönder. MEN ÄH. En månad till ska den väl hålla? Hoppas vi.


Dagens Bröst Bild

Vill ni slita huvudet av mej nu? Eller kanske informera mej om hur äcklig jag är? Och för att inte glömma, ful. Och fy äckel jag, skämmas borde jag. Säljas, de e d vad jag borde. För jag kommer väl knappast någonsin få ett jobb igen eftersom att jag har bröst ute på internet. Nej guuuu, hata mej snälla snälla snälla.


Ni vet, jag är fortfarande i trotsåldern. Säg att det är något ni hatar, inte vill se mer utav, något ni inte tål, något ni vill jag absolut ska sluta pronto med punkt precis just nu. Ja, då gör fröken Pessi precis motsatsen till vad ni vill. Suckers. Min blogg mina regler, eller hur? He.


FMF




Skrillex! Lovar, det är Skrillex, även fast man inte kan se det.. Han rockade, som sagt, sönder stället. Tråkigt nog var vi sena att ta plats för hans show, så stog miljoner meter ifrån scenen (vi stog typ mitt i en moshpit, haha, visste för faaaan inte de hade moshpits på annat än hård rock och shit..). Men han e kanske inte världens sötaste kille att titta på så det gör väl inget. Men hade bästa feelisen ever! Jag hade perfekt nivå med alkoholen, en pojkvän, 2 vänner och awesome musik, så nej men säg mej hur man förklarar perfektion på festival om inte så? Skrillex valde perfekta sånger att spela och, som ni ser, så var efekterna coola. Han spelade ganska så tidigt, runt klockan 4, så med tanke på det så gjorda han så jävligt bra ifrån sig och publiken avgudade honom.



Tinie Tempah. Matilda (som tagit bilderna) och Simon stog tydligen jätte långt bak under hans spelning. En kille fixade mej och Tess till andra raden längst fram, så vi hade perfekt platser. Tinie var också asgrym, även fast jag hört typ 4-5 av hans låtar innan? Publiken älskade när han drog SHM med Miami to Ibiza. Boooom!!



Efter Tinie så spelade Fatboy Slim. Vilket jag klart ville se, men jag är inte världens största fan av honom. Och min alkohol nivå i blodet höll på att dö ut. Men eftersom jag & Tess, stog vid dethär laget, allra längst fram vad vi kunde komma, så var det absolut inte värt att riskera platserna för Swedish House Mafia som spelade efter Fatboy. Vi skulle aldrig i livet kommit ens till mitten av publiken om vi skulle lämnat nu. Tänk om jag skulle behövt kissa? Tackar gudarna för att det inte hände. Skulle gråtit tårar att mist front row. Så jaaa, första 15 minuterna av Fatboy var väl kul. Men han spelade varje låt så jävla länge och publiken höll på att somna. Och han påminner mej as mycket om Scooter, en gammal gubbe som en gång varit awesome dj men bara känns typ gammal och patetiskt now days.. Så jag kollade på klockan i 1½ timme och diggade till varannan låt..


Tomorrow

Vet ni vad som börjar imorgon?



Whop whop! 4 dagar av manlighet börjar.


Lunch



Jag vet inte, men varje gång jag käkar känns det som jag äter för mycket? Over-eating. Betyder det att jag gör det då, over eating, eller är det bara bra att känna sig fylld till gränsen till för mycket? Jag menar, en wrap med 1 körsbärs tomat, 3 cm gurka, morötter, lök, 2 sallads blad och 5 kycklingbitar kan väl inte vara för mycket? Eller??


FMF

Mera bilder!

Här har vi kommit in på festival området, runt en 1-2 tiden.

Vi är perfeeeeekt fulla och har toppen feelis. Ville ju självklart hålla upp stämingen så vi drack några drinkar. Dock kostade en burk Smirnoff Ice Black 11$. Seriöst, vem har råd att vara full? Inte jag. Men här är vi än sålänge glada, fulla och jätte excited över hur detta kommer bli!




Jessie J! Jag gillar inte henne överdrivet mycket men hon var duktig live. Har aldrig hört att hon är Brittisk men svårt att inte lägga märke till hennes dialekt live. Och så trodde jag att hon skulle vara tusen gånger sötare än vad hon egentligen e.





 Gym Class Heroooooooes! Super bra! Öppnade upp med Cookie Jar (låten jag absolut mest ville höra dem spela) och klart spelade dom alla de andra hitsen. Däremot blev jag förvånad att dom bara inte gör sån typisk pop, rapp, (whatever typ av genre de e) musik som jag allti trot, de hade flera låtar som påminde om den musik stilen som Linkin Park kör på.


Tisdags underhållning; Danska killtidningar


Sometimes... I GET A GOOD FEELING.

Jag minns när jag hörde Skrillex för första gången.. Sista veckan i November, sista veckan i Australien, ute på Roadtrip Melbourne-Sydney me Torben & Simon och vi gick igenom deras iphone musik.. Och så kom Skrillex med Scary Monster på.. Början var liksom, jaahaaaaa va e dähääääär? Och sen när låten drops it och de skriker i den då (o jaa bra förklaring men ni vet vad jag menar?) var det liksom bara WHATTHEFUCK?!?!?!?!?! Seriöst? Vad jävlar e dethär för musik? Vi böt snabbt som fan låt, innan vi höll på att skratta ihjäl oss och killarna försökte lista ut på vems jävla spellista den kom från.



Idag är jag totalt in love with Skrillex. Big time. Bästa musiken på läääääänge. Och han total rockade sönder festivalen igår. Jag är så kär i honom just nu. Kan inte få remixarna ur huvudet. You areeee a cinemaaaaaa, i could watch u foreeeeveeeeer.

Har har vi ett exempel från igår.
Ap dålig kvalitet på den youtube filmen,
som är filmad av någon från VIP,
men vänta tills han filmar publiken...
Fatta hur mycket folk det va!



Kan inte vänta på att få fixat biljetter till Tomorrowland och se honom igen!!!


FMF

Dags för bilder!

Som sagt så grundade, eller frukost, med alkohol klockan halv tie på morgonen.
Sen, runt 11, så tog vi tåget (som klart tog as mycket längre än normalt) inn till Melbourne och vidare till Flemington Race Course där FMF (FutureMusicFestival, daah) var. Vi var perfekt salongs berusade på väg in, liksom peeeerfekt. Sjukt taggad början.





You r, a Cinema..

Igår var AWESOME!!!! Fett asa jävla sug bra. Jep, så bra var det.


Tyvärr var ju det en 1-dags festival, där dom packat in ett grymt line up på x-antal många scener. Vilket innebar att man hade noll chans i världen att se alla band man ville se. Så väääääldigt tråkigt nog missade vi Flux Pavilion, Knife Party (Buhuuuuuhu!!), Paul van Dyk (!!), The Wombats, Dubfire, Orjan Nilsen och en massa fler...

Men däremot hade vi awesome platser på Tinie Tempah (2 raden) Fatboy Slim (2 & 1 raden) och Swedish House Mafia (längst fucking framme! WHOP!). Så hann vi också se Jessie J, Gym Class Hereo, lite av Professor Green och sjävlklart Skrillex. Jag har svårt att välja om Swedish House Mafia eller Skrillex var mera awesome. Men SHM vinner nog i det. Ni har ingen aning om hur galet bra dom va. Ljus/rök/eld/serpentini efekter i varannan sång, de spelade inte låtarna allt för länge (som Fatboy Slim gjorde) och de var sjuktsjuktsjuktsjukt proffsigt bra. Och de spelade Aviici - Levels (som också de flesta andra gjorde med sin egna mixar), vilket var så otroligt himmla feelis så jag nästa dog.

Hur jag än förklarar, så ni vet, kännslan att vara på festival, att stå och digga, dansa och njuta av bandet du älskar samtidigt du skrika lungorna ur dej, går inte att beskriva.



Och shiiiiiit, kollade precis videoklipp som kommit upp från igår på Youtube. Fi faaaaaaan va grymt de va.
Sätter upp lite här för er senare! Whop whop whop. Ska fixa fram lite riktigt proffs bilder från internet jag kan visa här på bloggen så ni får lite mera rätta kännslan utav det hela.. Ni kommer få läsa om dethär för en tid frammåt..


UNTZ

Jag har bilder och storys från gårdagens BÄSTASTE festival på gång.
Kommer snaaaaaaart..




Sista Svaret; Hora

Okeeeeeej, förra bilden fick kommentarer om att jag klär mej som en hora. Ok. Så fint sagt, tack, gillar dej med. För jag gick ju ut på gatan klockan 12 på natten och sålde mej själv, ni vet lite ont med pengar now days. Därför jag hade på dom kläderna. Jag gick ju inte på FESTIVAL. Har du varit på festival? Nej tydligen inte.

Vi kan göra lite gemförelser här. Bara för att..

Dehär är fröken Pessi i hor kläder.




Dethär är en riktig hora.
Eller åtminstone mera hora än mej, för sen när har jag tatt betalt?




Sen att jag skulle gjort en bröstförstoring?
Vadå? Seriöst? Tycker ni mina ser ut såhär




Okej kanske de gör det på bilden, höhö. Men ni vet, om jag skulle satt upp den bilden och haft små tuttar skulle ni inte gett ett fuck i att kommentera den. Eller hur? Nästa gång lovar jag sätta på mej en säck så ingen kan se mina kurvor för ni klarar verkligen INTE av det. Inge mera tuttshow för er! (ööhöhöhöh, vem försöker jag lura, klart ni ska få se mera tits. Mera bröst till folket!)

Och atention whore? Jag gissar att jag är? Jag skriver en offentlig blogg, överdriver den och bjuder på mej själv. Jag vill ni ska läsa den. Så.....?

OCH NU slutar jag uppmärksamma era no-lifers kommentarer i bloggen, för ärligttalat, va håller ni på med? Försöker ni ändra mej till någon jag inte e? Låt mej köra mitt race, ha roligt och göra vad fan jag vill utan att bli kritiserad? Okej? Inte direkt så jag kritiserar er? Var istället tacksamma för att jag delar med mej öppet av mitt liv och äventyr istället för att dra ner mej? Men gissar det är därför det är så enkelt roligt att hitta felen och slänga skit på mej va? Men om jag sönder provocerar er, sluta läsa :) Enkelt, problemet löst!! Är ju faktist inte inte en jävla böld i erat anus ni inte kan undgå.

Sen känns det faktist awesome att veta om jag får en dålig kommentar så får jag alltid back-up kommentarer av andra läsare. Jag älskar er som inte dömmer, och är glada för mej. Ni betyder asmycket och det är för ER jag fortsätter och bloggar på denna sida. Annors skulle jag byta, göra en hemlig blogg och inte ha en enda Jeppis-läsare.


Future Music Festival, here I come!



Tuttaaaaaar


Frukost!


Fuskar


16½ timme tills..




Joey

Som sagt så kolla vi War Horse igår. Awesome. Väldigt välgjord, lite överdriven, men jätte vacker. Jag skulle gråtit 5 liter tårar, (om jag inte skulle haft manligt sällskap) för att den fick mej att sakna Prince såhääääääääääääär jätte mycket.. Så jag tror jag älskade filmen bara för att jag är en 110% häst-människa? Och Simon är krig-film-människa, så jag gissar det är därför han gillade den? Annors vet jag väl inte om jag skulle rekomenderar den för normala dödliga? Jag tycker ju det är totalt bortkastad tid att kolla på en 2½h lång film. Men häst- och djurmänniskor kommer äääääälska den, lovar.






Skrillex

Snäll säg att jag inte är enda som tror att de seriöst sjunger


Salsa on my balls boys
Sa-sa-sa-sa-sa-sa
Salsa on my balls boys
Sa-sa-sa-sa-sa-sa
Green brownie..




Möhöhöhöh! Nej men får väl ta o höra med egna öron imoron på festivalen? Booooom



Största Diva i-landsproblemet någonsin

Jävla skiiiiit. Har väntat i en månad på att fixa mina naglar
inför Future Music Festival, och för Formula, och så fuckar det upp sig.


Jag har haft sånt jävla sug efter naglar efter jag tog bort akryl naglarna för 1½ månad sen, men i brist på pengar så tänkte jag att jag sparar med att göra dem tills festivalen, så dom e färskt fräscha och fortfarande awesome för Formula One veckan efter. Men efter att min budget gått super dåligt den senaste veckan så övervägde jag istället bara köpa gör-egna-hemma-enkla-lösnaglar istället för att göra dem på salong. SVIN IDÈ JESSICA. Köpte ett märke jag inte prövat tidigare, ett bättre och dyrare märke, och så är limmet torkat. TORKAT. Seriöst, hur b-produkt e inte det?



Och nu hinner jag inte gå ner och köpa nya för allt e stängt, och vi åker till festivalen imorgon bitti. I-LANDSPROBLEM. Så inga fräscha snygga fake naglar på festival, hur faAAAn ska jag öVeRLeVa? Går icke.



Jaaaah, Diva Queen forever <3 Nej jag skojar (det finns ju en del utav er som faktist inte fattar det, eller hur?), världen går inte under. Bara lite. Men får slänger på något fult rosa nagellack istället. Det börjar låta som jag läst för mycket scandalbeautie bloggar, när jag skriver om att världen går under för att jag bryter eller inte kan göra naglar? Men, note to myself; betala 20 dollar extra och få dem gjort i akryl på salong nästa gång.


Movie Time





Avatar kommer ta Dej

Men alltså guuuuu så sliten jag varit idag. Och nej, jag är ju inte än SÅ gammal än att jag är bakfull i 2 dagar efter utgång. Kanske jag håller på att bli sjuk? Eller kanske det är för att det var fullmåne inatt, jag sparkade Simon i sömnen och hade mardrömmar.

Jag drömde om att en utav grannarna hade målat sig blå med målarfärg och använda Avatar byxor, och han hade en slav på bakgården som kröp på alla fyra och Avatar mannen spetsade honom med ett spett i rumpan. På något sett fick Avatar tag på mej och jag fick välja om jag ville dricka frätande syra eller ta 15 frätande piller istället. Så jag tog pillrena. Vill ju inte få ont i halsen va? Ganska okej snällt av honom att låta mej få välja också? Och så väntade jag på att min mage skulle börja fräta. Mysig känsla att veta att jag DÖÖÖÖÖR. Sen dog jag aldrig, bara fick lite magont. Sen sprang jag fri och gömde mej i huset. Så bra tänkt där, för grannen skulle ju säkert aldrig komma hem till vårt och leta efter mej där va? Jag tror jag skulle vara en utav dedär typiska blondinerna i skräckfilmerna om något såntdär skulle hända på riktigti? Skriker, flaxar med armarna och springer i fel riktning. Eller glömmer att jag har klackskor på mej och tror man springer snabbare i dem? Nej skoja!!!! Eller?



Iaf, är sup3r slit3n girL idag. Har inte tränat nått på 2½ (!!) dagar nu och tror jag gått upp 4 kg från en ute kväll. Jag drömde det också. Hoppas jag känner mej bättre imoron och kan wannabe träna ihjäl mej. MÅSTE.


Köttbullar


Livet i en Reseväska

Jag e så organiserad!



Amatör

Vet ni hur många blåmärken jag har efter igår?
2 469 stycken! Skojar inte. Kom och räkna.

Dock ser det ju inte så överdrivet brutalt ut på bild
och som att jag bara ringat inn random hud, men ickeeee.



Nej men seriöst vad har jag på gång när jag är ute?
Hur får man blåmärken på hela fram benen, på röven, på armarna och överallt.
Tror folk misshandlar mej när jag super eller nått? Sparka på hon som ligger!!!


Wanna Fight?



Förresten, till allas kännedom,
så meddelar mina två vänner
att om ni muckar med mej, Pessi,
så muckar ni med dom två också.





Jag vet, ganska skrämmande va?
Jag skulle då inte starta en fight med mej själv
när jag vet jag har två svenskar bakom mej. Hoohujaah!


Pessis pojkvän

Här kommer vad ni väntat länge på!
Interjuv / frågestund med min andra hälft.

(fick förresten förslag om att jag borde filma honom när jag pratar
me honom, eller när han snackar danska. Vi tar det en annan gång, okej? puss!)



Snabba frågor:

Mellannamn? - I don't have any middle name
Sko storlek? - ffffff42
Penis storlek? - U CAN NOT ASK THAT. And you know
Favorit färg? - Mmmm? Blue!
Favorit flickvän? - Mmmmmmmmm? Jessica Birgitta Edström
Favorit klädmärke? - *gör konstiga ljud* mmm? Henry Lloyd
Favorit artist? - The Game
Tuttar eller röv? - I dont know!!! Tuttar
Blondiner eller brunetter? - Blondiner, hehe
Finland eller Danmark? - DENMARK
Spoon or get spooned? - To spoon!


Längre frågor:

Förstår du Jeppis dialekt? - mm!
Vad tycker du om Jeppis efter alla historier du fått höra om stället? - Now I have to be careful what i say?! Small? And... I don't know. Finnish! Small and Finnish! And I can't say it's crap becuse i haven't been there.
Vad är ditt livs motto? - Aaargh? *gör konstiga ljud* Work hard, get paid!
På en skala mellan 1 och 10, hur awesome är du? - I can't say that!
Vem är din förebild, förutom din AWESOME flickvän? -HAHAHA, lie... Mike Tyson!
Om du vore ett djur, vilket djur vore du då? - Lion!large cartoon lion graphic
Om du hade superkrafter, vad skulle du ha? - Fly! What do u mean that I'm thinking nasty?! NO.
Favorit del på din AWESOME flickvän (förutom fittan)? - Mmm? I dont know?! Your butt. Or your face.
Hur mycket tycker du om din AWESOME flickvän? - *visar med armarna* This much! Like a blue whale. I don't know. Alot?
Berätta ett skämt - I don't.. I don't.. I'm not good with that! I could tell you the one with Tess and sperms, but i can't. Wait, what are you writing down now? YOU CAN'T WRITE IT DOWN. STOP!




Pest eller kolera:

Att aldrig få träna och äta McDonalds en gång om dagen eller jobba som vakt utanför Danska slottet (hans gammla jobb) resten av ditt liv?
- I would be the gard. Even if it's pretty boring. Els I would be fat. What would you like?
Att lägga på sig 20kg fett som du aldrig kan bli av med eller behöva bosätta sig i Frankston för resten av livet?
- If you can live up there in Frankston South, thats okay!
Att ha sex med ett Frankston luder (SKANK) eller inte ha sex på ett helt år?
- YOU CAN NOT PUT THAT ON! I HAVE A GIRLFRIEND!!!



Era frågor:

Mia:
1. Vad gjorde att han föll för dig? :)
- I dont know? You pretty cute? And you have blonde hair! And you have nice eyes! And you like to have fun! And you lost in goon pong! And you like to drink!
2. Vad är hans drömjobb?
- What is my dream job? AAAH pro snowboarder! It isn't a real job? Mmm, I dont know? Owner of my own comapany?
3. Hur seriöst är ert förhållande? (planer på förlovning, giftermål , barn osv...?) 
- *ger mej en konstig blick* What? Do u want me to answer that? We have to adopt a kitty first!
4. Vilka språk kan han?
-
All of them? Svenglish, danish, norwegian, german, english.
5. Har han några syskon?
- I have a sister!
6. Har han varit med i någon sport?
-
I played soccer. And boxing, and snowboarding

Nyfiken:
1. Kommer ni flytta tillsammans i Danmark/Finland?
- Danmark. Right?! But, yeah ofc we r. Right?!?!?!?! Good.
2. Har Pessi gjort silikonbröst eller bara gått upp i vikt under året?
- She just got fat. Noo..
3. Drömjobb?
- My dream job..? Mmmmm.. I would like to sell stocks.

Jensku:
vad planerar han göra de närmste året, två åren?
kommer han till finland med dej att stanna? =)
- Are we not going to Sweden?! It depends.. It depends..

Karro:
Fiser pessi mycket? ;) haha
- Jess do not fart alot. She is well behaved. Except from when she is shitfaced, then shes not well behaved..

Tess:
hur träffades ni??? muhahahhaha
- I met u... On the balkony. And I didn't say hi! In Frankston.



Och rumskompisarnas frågor:

Matilda:
Hur känns det att gå på Future Music Festival på söndag med 3 tjejer?
- Mmmmm.. SHIT. Naah. I wanna go with you, Jess. I don't wanna go with the other ones. I don't like them. I hope they pasout infront of the scene with their boobs out n gonna be like woooooh Swedish House Mafia. HEHEHE.
Och hur full kommer du vara?
- Im not gonna be Finnish drunk. Or Swedish. I gonna be proper Danish.
Hur ska du göra med styrketräningen när du är ute och reser?
- I'll take 400 push ups a day. And jogg.. Around the car.. When you are driving.

Tess:
Hur kommer du överleva utan att träffa mej, Tess, varenda dag?
- Hihihihi. I gonna be the happiest guy on earth.


Dinner; - crispbread with avocado & egg


Bite Back

Tack för att ni gullisar peppade upp mej
efter dendär loser kommentaren här om dagen.

Sen blev jag också attackerad med en annan kommentar av en no-namer som heller inte vill se mitt face igen för att jag är falsk, inte bryr mej och har förlorat en utav mina bästa vänner och uppmaner mej berätta ut det på bloggen om vad som hänt. ÖÖÖÖH? Försöker nån fucka med mitt huvud eller har något hänt jag inte har en jävla aning om eller totalt förträngt? Jag är ledsen, men jag vet först och främst inte vem det (eller du) är, jag har inte mist någon nära vän (inte vad jag vet om, o jag vet inte hur det e med er, men jag lägger väl för fan märke till om jag har en "bästa vän" som är arg på mej och "gör slut" med mej?) och i så fall, förlåt, men det var nog inte en sån nära vän om jag fan glömt och raderat dej totalt från mitt minne? Eller pratar vi om nått för 2,3,4,5,6,7,8,9 år sen eller? Då kanske vi kan move on istället för att ha en gammal förträngd bild av mej va?

Men påminn mej gärna i ett e-mail eller på facebook istället för att göra påhopp anonymt på bloggen, okej?
Sen lovar jag berätta det offentligt, i minsta detalj om du söta vän så gärna vill.


Och för resten av er som har problem med mej, ta gärna kontakt med mej så ska vi väl fixa upp det, va? Skype deit om ni så vill. Boka ett ledigt datum för att gå på kaffe med mej när jag kommit hem. Sänd mej ett sms. Ring mej. Men för fan, gör det inte fucking anonymt. Suckers.




I Like Him


En Gonatt Historia

Om ni har läst mellan raderna på bloggen så kanske ni missat det, men iaf, det är FUTURE MUSIC FESTIVAL på söndag. TAGGATAGGATAGGATAGGA! O nu menar jag tagga, som att tagga 5 dagar på förhand med alkohol tagga. Så jajjamensan, vi gick ut igår. Nu snackar vi om all in Magaluf Style utgång. Finlandia, Tess on the Beach och Spyan rockar Australien minst lika mycket som Mallorca, kan jag lova.

Iaf, jag har en kompis som jag mötte i Nya Zeeland förra året som bor här nere i Melbourne. Jag har inte sett honom och hans flickvän på över ett år så jag vill ju självklart catcha up me dem. Han dj:ade på Room 680 igår, så vi gick dit på parteeeey. Världens längsta kö vid dörren som vi drog förbi, mahaha. Hängde i dj båset (coola vi e va?????), dansade, drack.. Och sen decka jag på toa (HAHAHAHA AMATÖR) och åkte därifrån redan halv ett (HAHAHA AMATÖR). Nej seriöst, jag har inte varit full på 2 månader och dricker vodka som en finsk kärring (fast ja e ju! höhö, e så rolig) så klart jag dör. Hjärndöd här. Och jag har varit i det formstadiet att jag tagit tequila shots. TEQUILA SHOTS. JAG, PESSI, och tequila shots. Ni vet, everyone has a tequila story (SANT ELLER HUR?!) och min e inte bra (ni kan få höra den senare) och kan ABSOLUT inte dricka tequila. Efter min one-and-only time med tequila shots så har jag slutat  med min favo drink, Long Island Ice Tea, bara för att tequila smaken plötsligt uppenbarade sig as-starka i dom. Pöh. Iaf, jag drack tequila igår. Hörde jag, jag minns inte. Iaf, efter att jag blivit släpad, dragen och bärd (ja, det är totalt vanligt att jag tappar stå, gå och överlevnads förmågor när jag är shitfaced. Är det normalt?) så vaknar jag upp hemma hos min kompis. Så vi övernattade där, och tur va väl d för annors skulle vi behövt vänta 5 timmar på nästa tåg och jag är säker jag skulle hunnit slängas in i en fyllecell innan dess.. Sen hade vi världens walk of shame idag morn. ASAROLIGT. Hej, jag är Jess, aka dagdrivare, och tar tåget hem samtidigt som du tar tåget till jobbet. TUMMEN UPP.


Vi var foamparty klädda eftersom vi skulle på foamparty som dom hade i en annan del utav klubben igår. Men det var asa lång kö till det väl där inne, så vi skippade det. Så därför får ni inte kritisera vår klädsel. Och så har jag inga flera bilder än så här att visa er, för att väl inne på klubben sabba jag Matildas kamera, möhö.



Oså käka vi McDonalds på vägen hem (HIHIHIHI, 2 månader sen sist. Var inte ens nära så gott som jag minns det. SÅ inte värt det). Hur som hellst, vi är uppvärmda inför söndag och nu blev jag än en gång påmind om var mina alkohol gränser går, så det borde inte fucka up mej då. Kan absolut inte inte INTE missa Swedish House Mafia.


11:40 am - just got home from last night


Vad använder Pessi för Underkläder? Anteckna.

Idag har vi varit nere på Frankston city och små shoppat.


Intresseklubben antecknar nuuuu
.
Mitt största mission var en push up bh, och jag hittade två, jippie alltså vilken lycka. Och jaaa jag vet, leopard print och märket Playboy låter ju lite väääääl trashigt och super wannabe, men den sitter asbra på och jag nästan älskar den. Iaf i provhytten, allt brukar ju inte se lika bra ut på väl hemma? Fick hjälp med storleken också, så fick gå upp ännu en kup storlek än vad jag köpte senaste. HEHEHEHE.


Sen när biträdet berättade att en bh håller 3 gånger längre om man tvättar dem i tvätt-påsar så kunde jag ju inte motstå att köp en matchande påse också. Vill ju inte betala miljoner för saker som håller kortare än vad de kan?



Sen hittade jag en annan helt okej push up för 7$ (!!!),
även fast den var i fel storlek så får den duga.
Pluss att rött e väl sexigt kul?




Och så kom jag hem med en påse från Supré som inehåller
två snygga toppar. Ni får se dem senare när jag bär dem!


Uppdatering

Nu e klockan e 20 över 10 på kvällen, jag håller på att spränga mina trumhinnor med Skrillex (det är alltså en bra grej, inget negativt med att spränga öron med Skrillex va?) och taggar inför nån typ av wannabe träning. Sen ska jag dricka en proteinshake, duscha, ha sex och sova. Mjä, kan man ha det bättreeeeeee? Gonatt töntar!

Såhär ser det ut efter träningen, mummmma


puss på dej mitt största fan!

Hur otrolig är jag inte?! Kan inte komma längre bort hemmifrån än vad jag är (det är ju faktist sant?) och jag upprör folk fortfarande?! Shit, kan man annat än älska att hata mej eller vad är det frågan om? Hur avskyvärd kan man bli? Kan jag få ett pris för det? SnÄÄÄÄLLa?




Och jag älskar det faktum att denna lilla söta tös eller gosse faktist tagit sig tid att söka upp min blogg bara för att se den, blir mera irriterad och spy ut sitt hat. Oj shit jaa, visst älskar man att hata mej. Puss på er utan liv <3


Everytime I hear this Groove ..

.. it makes me wanna move.
It must be the Feeling.






Alkohol, Sex å Droger?

Idag pratade jag med en gammal kär vän, som tjuvkikat och följt mitt liv inne på bloggen då och då. Han frågade om mitt liv är så som tv showen Kungarna av Tylösand? HAHAHAHAHA. Bästa frågan på länge.


Jajjamensan!
Pessi goes Australia (eller nu just; livet som en Frankston brud)
/ Kungarna av Tylösand, same shit different name eller vadåååådå!








Iaf kan vi ju säga att min blogg är
lika patetisk som Kungarna av Tylösand, va?



Beroende

Whop whop, season 2 Kourtney & Khloe take Miami


Favorit i Repris; - BE STUPID


Ööööh NATTHUMOR<3




Allergitablett

Jag har fått en massa äckliga utslag (fast jag tror det är soleksem efter att jag brände mej för 2 dagar sen? Och egentligen syns de inte om du inte har ett förstorningsglas) så jag försökte ta en allergitablett mot de idag. Jag total dog av tabletten. Jag var vaken i 4 timmar, käkade potatis, kött och ost (döööö Pessi dööö! får man beach body 2012 av mat som det? NÄ.) med blåbärspaj och glass till efterrätt (DÖÖÖÖ!!) och sen så somnade jag. Och sov i 3 timmar!!! Öh? Nu är jag världens lataste och MÅSTE träna för enda jag gjort idag var en mega kort PW runda. MÅSTE-TRÄNA-NU.



Note to myself; ta aldrig en allergitablett innan du hård-tränat.


White Trash

Är jag den enda som tycker att dehär med svenska pattlisor som använder bikinis med deras kära svenska flagga trycken på är det fulaste som finns? Är det inte också ganska typiskt Sverige? Stor bröstad blondin med perfekt solbränna. Nä vadå, jag är inte avundsjuk?!




Haha, tänk er bara synen med en finne i en blåvit bikini (vilket självklart aldrig skulle hända?). Jag ser det framför mej.. En blek finne, svart FLOTTIGT hår, lite finnar och röda fläckar i hela fejjan (och gärna lite frampå åvanför brösten och på ryggen), dålig hållning, inga bröst, ingen röv och tittar blygt ner i sanden. Och en blåvit bikini. ÅÅH FINLAND<3




Batman Himmel och Böneburkar

Kolla så cool himmlen var igår på väg hem från AFL!




Och hittade världens största MAN BEAN burk. MMMMMMMMMMMMMMMMMMM..




On the Footie with 12 954 people

Som sagt, igår åkte vi in på AFL match (Australian Footboll Leauge). Australiensk fotboll är inte som vanlig, vad vi kallar, fotboll hemma, utan det är mera som (om blodnin nr 1 som har noll fotbolls kunskaper ska förklara med egna ord) ; rugby. Fast inte lika biffigt och brutalt som Amerikansk rugby, utan mera spring och smidighet. Så typ inte alls som vanligt rugby då heller alltså. Så den där förklaringen gjorde ju ingen nytta. Men nåja, allt är ju lite up-side-down här nere, HÖHÖHÖHÖ. Öh okej, försöker dra gammalfolk humor här nu, ni vet, sån som de tror är asarolig som egentligen suger kuk men så skrattar du endå för du tycker synd om dem....  Eller va.

Här är bilder!



Det var helt skojsi mojsi att komma iväg bort från Frankston och göra något annat än sitta hemma och supa en lördagskväll. Och jag menar, killar med korta vita shorts och lårmuskler som tjurar är väl aldrig en tråkig syn?! Vi hade alla jätte trevligt och jag tror jag också faktist fick någon uppfattning och idé om hur spelet gick till. Iaf fatta jag vilket lag som var vilket (och vilket lag vi hejade på!) och det är väl en början?







Triumph Sport Bra

Yeeh, jag hittade en sportbh! Den lovar ultimat stöd, den var asadyr (eller långt över min budget iaf), det är ett bra märke och den håller väl Big Mac'sen på en sisådär bra plats? Iaf när man kängurru hoppar i omklädningsrummet på Rebel. Och så blev jag lite trött på att pröva bh:r så jag gissade att jag inte kunde hitta nått bättre än denhär.. Och sen om jag nu betalat en förmågenhet för den och fortfarande kommer har stuntsande bröst, när jag är ute på mina wannabe jogging rundor, så kommer jag börja gråta. Eller har man returrätt på sport bh:r? Jag får ta o kolla up det. Men jag är säker på att denhär ska göra sin funktion. För jag kommer gråta ännu mer om jag får häng-pattar av att springa med dålig sport bh.

Tadaaaaaa! Inte typ världens snyggaste,
men den ser bättre ut på, lovar! Visar er nån dag om jag e på bra humör?



Och, ni vill inte ens veta vilken kupstorlek den är för ni skulle skratta ihjäl er. HEEEHEEEEHEEE.


Blåbärspaj!


@ the Footy Game, Etiahd Stadium


AFL Footy Tonight!


Best Shit Ever


Chai Tea!


Idag är det Kallt




Team Awesome

Idag har min dansk och jag varit tillsamans i 3 månader. Grattis på oss



Och som en perfekt 3 månaders dag så kör jag just nu på en inte-prata-med-Simon-strejk på grund av olika anledningar. Jag vet, lite 5 års fasoner, meeeeeen.. :)


Tjolahopp!

Jag fick en sånahära awards grejsa mojs av Andrea. Egentligen orkar jag inte hålla på med sånt, skriva ner 7 saker om dej själva, skriv ner 15 andra bloggare du vill ska göra det samma och blaha.. Men bara för att jag är uttråkad kan ni få 7 omtiverad fakta om mej. Är ni beredda för dehär?


1. - jag tror jag minst lika mycket tycker om att spana på girls som på boys? Jag gillar allt vackert. MEN OBS, INTE på ett bi eller lesbiskt sätt!!!!!!! Utan bara för att kritisera, kopiera, gemföra och ta efter. Ni vet hur vi tjejer e..
2. - jag hade, (alltså oskojat! skämtar ickeeeee!) alkoholproblem för ett par månader sen. Haha, jag vet, vem kan ta det seriöst när en 20 årig fjortis tjej säger så. Men skojar ickeeeee!! But I'm fine now!
3. - pluss att jag inte får något ut av att dricka alkohol i mitt liv just nu. Förutom att gräla med pojkvännen, ha attitydproblem, go mental psyko kärring crazy och allmänt bara fucka up. Hur kul låter det egentligen? Jag tappar min egen personlighet lika snabbt som jag dricker en Smirnoff Ice.

4.
- på tal om Smirnoff Ice, jag kan halsa en Smirnoff Ice på noll tid. Eller typ 10 sekunder. Som inte låter som nolltid utan mer som en evighet. Men iaf, är säker på jag gör det snabbare än vad du klarar av, biaaaatch, höh!
5. - för att orka skippa godis och ta en extra pusch up så suger jag ut insperation från att kolla in scandalbeuties.com bloggar 24/7. Och Kissies.
6. - om jag vore fitt och tränad som en apa så skulle jag sätta på mej en bikini och posa i killtidningar. Vilket aldrig kommer hända eftersom jag aldrig kommer bli så pass vältränad.
7. - jag håller på att göra världens mest nödvändigaste grej. En things-to-do-before-u-die lista. ETT MÅSTE. Jag har redan också hunnit kryssa av en massa på listan, bra va?


och så en bild utav me myself and I från precis exakt just nu.
Och, försäkerhets skull, för att inte få några elaka kommentarer så
paintar vi över ansiktet och klyftan för sånt är ju bara "äckligt".
Okej, bra, alla nöjda?! Pöh, die motherfuckers die.



Right now..


It's Autumn Time!

Idag var det offeciellt den första dagen på hösten i Australien.
DÖÖÖÖÖÖ! Kommer jag få en höst depression nu eller nått???!?!?!



Nejdå, oroa er inte för mej (som om ni någonsin skulle göra det, höh.). Vi stannar ju bara 3 veckor kvar här nere i Melbourne (där det blir som kallaste. Fast inte för att det någonsin blir riktigt tråkigt kallt på hösten, så jag har det fortfarande bättre än er (!!!), men iaf..) innan vi åker iväg backapackandes mot varmare delar av Australien. Pluss att jag är über taggad för de 3 kommande helgerna så de spelar ingen roll om det blixtrar, dundrar, regnar, haglar, blåser, är molnigt, soligt, på minus eller på pluss gradern (här i Melbourne har vi allt detdär på en dag, slå det ni va!!). Ni vet, musik festivalen nästa, veckan efter det Formula, och redan denhär helgen har vi nått kul på gång! Som jag inte berättar om nu bara för att retas, muhahahahaha.


Kommer inom snar Framtid

Jag fick en kommentar på bloggen om att jag borde intervjua min pojkvän.
JAAAAAA, vilken bra idé! Han lovade till och med att låta mej få göra det,
OCH låta mej skriva in allt på bloggen. Awesome.



Har ni några töntiga frågor till honom?


Vem ska få Vykort?


2014
Jan
Feb | Mar
Apr |
.
2013
Jan
Feb | Mar
Apr | Maj | Jun
Jul | Aug | Sep
Okt | | Nov
Dec
.
2012
Jan
Feb | Mar
Apr | Maj | Jun | Jul | Aug | Sep| Okt | Nov
Dec
.
2011
Jan
Feb | Mar
Apr | Maj | Jun
Jul | Aug | Sep
Okt | Nov
Dec
.
2010
Jan
Feb | Mar
Apr | Maj | Jun
Jul | Aug | Sep
Okt | Nov
Dec
.
2009
Mar
Apr | Maj | Jun
Jul | Aug | Sep
Okt | Nov
Dec
bloggar